Transcript: Mouse XM_006509827.3

PREDICTED: Mus musculus dynein cytoplasmic 2 heavy chain 1 (Dync2h1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dync2h1 (110350)
Length:
13646
CDS:
307..13227

Additional Resources:

NCBI RefSeq record:
XM_006509827.3
NBCI Gene record:
Dync2h1 (110350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509827.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217361 GAGTATCCTGCTTCGAATAAA pLKO.1 9045 CDS 100% 15.000 21.000 N Dync2h1 n/a
2 TRCN0000254341 GAGTATCCTGCTTCGAATAAA pLKO_005 9045 CDS 100% 15.000 21.000 N Dync2h1 n/a
3 TRCN0000254342 GCAGCGAGGTTTAGATTATTT pLKO_005 7110 CDS 100% 15.000 21.000 N Dync2h1 n/a
4 TRCN0000254340 TCACTTAAGGAATCGTATAAA pLKO_005 10723 CDS 100% 15.000 21.000 N Dync2h1 n/a
5 TRCN0000254343 TGAGGCTAACAGCCGAATAAT pLKO_005 1971 CDS 100% 15.000 21.000 N Dync2h1 n/a
6 TRCN0000215465 GTATTTGGTGGTAGGTATTAA pLKO.1 13429 3UTR 100% 15.000 10.500 N Dync2h1 n/a
7 TRCN0000254344 GTATTTGGTGGTAGGTATTAA pLKO_005 13429 3UTR 100% 15.000 10.500 N Dync2h1 n/a
8 TRCN0000197540 CCTCTTGAATACAGAAGTAAT pLKO.1 6706 CDS 100% 13.200 9.240 N Dync2h1 n/a
9 TRCN0000176566 CGCTTCAACAAAGTTGATGAA pLKO.1 4405 CDS 100% 4.950 3.465 N Dync2h1 n/a
10 TRCN0000178143 GCAGAAGTTCATCCCAACTTT pLKO.1 11734 CDS 100% 0.563 0.394 N Dync2h1 n/a
11 TRCN0000050900 GCCAGCAAGATGTACTTCATT pLKO.1 10798 CDS 100% 5.625 3.938 N DYNC2H1 n/a
12 TRCN0000288723 GCCAGCAAGATGTACTTCATT pLKO_005 10798 CDS 100% 5.625 3.938 N DYNC2H1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509827.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.