Transcript: Mouse XM_006509831.3

PREDICTED: Mus musculus baculoviral IAP repeat-containing 3 (Birc3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Birc3 (11796)
Length:
2557
CDS:
212..2020

Additional Resources:

NCBI RefSeq record:
XM_006509831.3
NBCI Gene record:
Birc3 (11796)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012299 CCTGCGTTATACAGAGATATA pLKO.1 1760 CDS 100% 13.200 18.480 N Birc3 n/a
2 TRCN0000012300 CCGTATTAGAACATTCTCTAA pLKO.1 982 CDS 100% 0.495 0.693 N Birc3 n/a
3 TRCN0000297353 CCGTATTAGAACATTCTCTAA pLKO_005 982 CDS 100% 0.495 0.693 N Birc3 n/a
4 TRCN0000012298 GCATTTATGGTTCAGAAACTA pLKO.1 2394 3UTR 100% 5.625 3.938 N Birc3 n/a
5 TRCN0000297352 GCATTTATGGTTCAGAAACTA pLKO_005 2394 3UTR 100% 5.625 3.938 N Birc3 n/a
6 TRCN0000012301 GCCAGATTACTCACCTATGAA pLKO.1 722 CDS 100% 5.625 3.938 N Birc3 n/a
7 TRCN0000297288 GCCAGATTACTCACCTATGAA pLKO_005 722 CDS 100% 5.625 3.938 N Birc3 n/a
8 TRCN0000012302 GCTGGCTATCCTCATCTACTT pLKO.1 1217 CDS 100% 4.950 3.465 N Birc3 n/a
9 TRCN0000280208 GCTGGCTATCCTCATCTACTT pLKO_005 1217 CDS 100% 4.950 3.465 N Birc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.