Transcript: Mouse XM_006509865.1

PREDICTED: Mus musculus CWF19-like 2, cell cycle control (S. pombe) (Cwf19l2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cwf19l2 (244672)
Length:
2965
CDS:
507..2951

Additional Resources:

NCBI RefSeq record:
XM_006509865.1
NBCI Gene record:
Cwf19l2 (244672)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173277 GCGTGATGAGTGGATGACTAT pLKO.1 947 CDS 100% 4.950 6.930 N Cwf19l2 n/a
2 TRCN0000175482 CGTGATGAGTGGATGACTATT pLKO.1 948 CDS 100% 13.200 10.560 N Cwf19l2 n/a
3 TRCN0000174512 CGAAAGAGAATTGAATCCATA pLKO.1 1079 CDS 100% 4.950 3.960 N Cwf19l2 n/a
4 TRCN0000216892 GAATGTGACAGCCACGATATT pLKO.1 924 CDS 100% 13.200 9.240 N Cwf19l2 n/a
5 TRCN0000193179 CCCAGATATCTGACAAAGAAA pLKO.1 868 CDS 100% 5.625 3.938 N Cwf19l2 n/a
6 TRCN0000216031 CTGGAAATTTGAGATCTAAAT pLKO.1 1570 CDS 100% 13.200 7.920 N Cwf19l2 n/a
7 TRCN0000121617 GAAGAAGAAGAAGAGGAAGAA pLKO.1 770 CDS 100% 4.950 2.475 Y ARL6IP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.