Transcript: Mouse XM_006509963.3

PREDICTED: Mus musculus Casitas B-lineage lymphoma (Cbl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cbl (12402)
Length:
9063
CDS:
154..2763

Additional Resources:

NCBI RefSeq record:
XM_006509963.3
NBCI Gene record:
Cbl (12402)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509963.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381278 GACACTTTCCGGATTACTAAA pLKO_005 676 CDS 100% 13.200 18.480 N Cbl n/a
2 TRCN0000042568 CGCACTGTCTTGTCAAGATAT pLKO.1 433 CDS 100% 13.200 10.560 N Cbl n/a
3 TRCN0000380139 AGGCGAAACCTGACCAAATTA pLKO_005 589 CDS 100% 15.000 10.500 N Cbl n/a
4 TRCN0000380089 GCTGTGCTGTGGCCCTAATTA pLKO_005 3062 3UTR 100% 15.000 10.500 N Cbl n/a
5 TRCN0000381199 ACCAACTCCTCAAGATCATAT pLKO_005 1209 CDS 100% 13.200 9.240 N Cbl n/a
6 TRCN0000295906 TGATCTGACCTGCAATGATTA pLKO_005 831 CDS 100% 13.200 9.240 N CBL n/a
7 TRCN0000380202 TGATCTGACCTGCAATGATTA pLKO_005 831 CDS 100% 13.200 9.240 N Cbl n/a
8 TRCN0000042569 CCTCGGAGAATCAACTCAGAA pLKO.1 2518 CDS 100% 4.950 3.465 N Cbl n/a
9 TRCN0000042571 GCAGACTATCAGCCTCTTCAA pLKO.1 528 CDS 100% 4.950 3.465 N Cbl n/a
10 TRCN0000042570 CCCACACAATAAACCGCTCTT pLKO.1 1101 CDS 100% 4.050 2.835 N Cbl n/a
11 TRCN0000042572 CCTGACCAAATTATCCCTGAT pLKO.1 597 CDS 100% 4.050 2.835 N Cbl n/a
12 TRCN0000039725 CCCTTCATAAAGACAAACCAT pLKO.1 1592 CDS 100% 3.000 2.100 N CBL n/a
13 TRCN0000010310 GACAAGAAGATGGTGGAGAAG pLKO.1 301 CDS 100% 4.050 2.430 N CBL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509963.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.