Transcript: Mouse XM_006510053.1

PREDICTED: Mus musculus MRE11A homolog A, double strand break repair nuclease (Mre11a), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mre11a (17535)
Length:
5357
CDS:
243..1895

Additional Resources:

NCBI RefSeq record:
XM_006510053.1
NBCI Gene record:
Mre11a (17535)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360339 GTAGGCTTGCTGCGCATTAAA pLKO_005 624 CDS 100% 15.000 21.000 N Mre11a n/a
2 TRCN0000012667 CACAACATCTAGCAAACGGAT pLKO.1 1772 CDS 100% 2.640 3.696 N Mre11a n/a
3 TRCN0000012664 GCGCATTAAAGGGAGAAAGAT pLKO.1 635 CDS 100% 5.625 4.500 N Mre11a n/a
4 TRCN0000012665 CGGTGGAGAAGGTTGACATTA pLKO.1 247 CDS 100% 13.200 9.240 N Mre11a n/a
5 TRCN0000360412 TCCGACTACGGGTGGACTATA pLKO_005 862 CDS 100% 13.200 9.240 N Mre11a n/a
6 TRCN0000012663 GCTTGTAAGAACTTGGCTAAA pLKO.1 2146 3UTR 100% 10.800 7.560 N Mre11a n/a
7 TRCN0000012666 CGCCATATTGATGCTCTGGAA pLKO.1 1239 CDS 100% 2.640 1.848 N Mre11a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.