Transcript: Mouse XM_006510069.1

PREDICTED: Mus musculus neural cell adhesion molecule 1 (Ncam1), transcript variant X18, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ncam1 (17967)
Length:
6692
CDS:
699..3383

Additional Resources:

NCBI RefSeq record:
XM_006510069.1
NBCI Gene record:
Ncam1 (17967)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510069.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113653 CGTTGGAGAGTCCAAATTCTT pLKO.1 794 CDS 100% 5.625 7.875 N Ncam1 n/a
2 TRCN0000335736 CGTTGGAGAGTCCAAATTCTT pLKO_005 794 CDS 100% 5.625 7.875 N Ncam1 n/a
3 TRCN0000373085 CAGCGTTGGAGAGTCCAAATT pLKO_005 791 CDS 100% 13.200 9.240 N NCAM1 n/a
4 TRCN0000113654 CCAAGCTCCAACTACAGCAAT pLKO.1 2067 CDS 100% 4.950 3.465 N Ncam1 n/a
5 TRCN0000335737 CCAAGCTCCAACTACAGCAAT pLKO_005 2067 CDS 100% 4.950 3.465 N Ncam1 n/a
6 TRCN0000113650 CCTCCAACCATCATCTGGAAA pLKO.1 1134 CDS 100% 4.950 3.465 N Ncam1 n/a
7 TRCN0000113652 CGTGCCCATTCTCAAGTACAA pLKO.1 2312 CDS 100% 4.950 3.465 N Ncam1 n/a
8 TRCN0000335658 CGTGCCCATTCTCAAGTACAA pLKO_005 2312 CDS 100% 4.950 3.465 N Ncam1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3483 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000140823 GAAGGAGAAGAAGGAGAAGGT pLKO.1 5 5UTR 100% 2.640 1.320 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510069.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.