Transcript: Mouse XM_006510166.2

PREDICTED: Mus musculus coiled-coil domain containing 67 (Ccdc67), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Deup1 (234964)
Length:
2495
CDS:
234..1844

Additional Resources:

NCBI RefSeq record:
XM_006510166.2
NBCI Gene record:
Deup1 (234964)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191892 GAGTTCATTATCGAGAAGTTA pLKO.1 900 CDS 100% 5.625 7.875 N Deup1 n/a
2 TRCN0000191691 GCTGAGATTACACCAAATGAA pLKO.1 560 CDS 100% 5.625 4.500 N Deup1 n/a
3 TRCN0000202371 GAAGGGAATGATGGGCGATTT pLKO.1 1319 CDS 100% 10.800 7.560 N Deup1 n/a
4 TRCN0000215447 GAGAAATGTAATCTAGTAATG pLKO.1 468 CDS 100% 10.800 7.560 N Deup1 n/a
5 TRCN0000190710 GCATTCACAGTGCACATCAAT pLKO.1 1382 CDS 100% 5.625 3.938 N Deup1 n/a
6 TRCN0000190555 GCATAGAGAACTGCTGAGAAT pLKO.1 1109 CDS 100% 4.950 3.465 N Deup1 n/a
7 TRCN0000190965 CCATTGGTTGGTGACAATGAA pLKO.1 1635 CDS 100% 0.563 0.394 N Deup1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.