Transcript: Mouse XM_006510349.1

PREDICTED: Mus musculus olfactory receptor 888 (Olfr888), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Olfr888 (258416)
Length:
1181
CDS:
225..1181

Additional Resources:

NCBI RefSeq record:
XM_006510349.1
NBCI Gene record:
Olfr888 (258416)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510349.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186708 GCAATGGCCTATGACAGATAT pLKO.1 597 CDS 100% 13.200 6.600 Y Olfr983 n/a
2 TRCN0000203797 CATCTCTCATGCAGAGTGTAT pLKO.1 521 CDS 100% 4.950 2.475 Y Olfr889 n/a
3 TRCN0000202630 CATGTACTACTTTCTCTTCAA pLKO.1 425 CDS 100% 4.950 2.475 Y Olfr885 n/a
4 TRCN0000185741 GATTGTTCTGATTGTGTTGAA pLKO.1 386 CDS 100% 4.950 2.475 Y Olfr885 n/a
5 TRCN0000204043 GCCTCTCTTCTTCCTCTTCTT pLKO.1 326 CDS 100% 4.950 2.475 Y Olfr888 n/a
6 TRCN0000187443 GCTCCCATGTGATTGCTGTTT pLKO.1 973 CDS 100% 4.950 2.475 Y Olfr888 n/a
7 TRCN0000188609 GAGTTTATCCTGCTGGGCTTA pLKO.1 282 CDS 100% 4.050 2.025 Y Olfr890 n/a
8 TRCN0000187333 CCTATGACAGATATGCTGCCA pLKO.1 604 CDS 100% 0.660 0.330 Y Olfr888 n/a
9 TRCN0000203412 CCCATGTACTACTTTCTCTTT pLKO.1 423 CDS 100% 4.950 2.475 Y Olfr887 n/a
10 TRCN0000188752 GCAGAGTGTATGACTCAGCTT pLKO.1 531 CDS 100% 2.640 1.320 Y Olfr889 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510349.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.