Transcript: Mouse XM_006510386.4

PREDICTED: Mus musculus junction adhesion molecule like (Jaml), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Jaml (270152)
Length:
3140
CDS:
1040..2053

Additional Resources:

NCBI RefSeq record:
XM_006510386.4
NBCI Gene record:
Jaml (270152)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510386.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127412 CCATGAATCCAGTTTGGCCTT pLKO.1 1983 CDS 100% 2.160 3.024 N Jaml n/a
2 TRCN0000127411 CCGCAATGATGGCTCAATCAA pLKO.1 1558 CDS 100% 5.625 4.500 N Jaml n/a
3 TRCN0000127413 GCTGTTCTACTATTCCAACCT pLKO.1 1132 CDS 100% 2.640 2.112 N Jaml n/a
4 TRCN0000127409 GAGAAGGAGGAGAGACTCTTT pLKO.1 2118 3UTR 100% 4.950 3.465 N Jaml n/a
5 TRCN0000127410 GCTCAGTAAGTTCTATGGCTT pLKO.1 1842 CDS 100% 2.640 1.848 N Jaml n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510386.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.