Transcript: Mouse XM_006510509.3

PREDICTED: Mus musculus cell adhesion molecule-related/down-regulated by oncogenes (Cdon), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdon (57810)
Length:
8185
CDS:
1001..4753

Additional Resources:

NCBI RefSeq record:
XM_006510509.3
NBCI Gene record:
Cdon (57810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510509.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438591 GTACTGGAGCATGCGTCAATT pLKO_005 1919 CDS 100% 13.200 18.480 N Cdon n/a
2 TRCN0000415608 TCTGTGGAAGTTCGTAGTTTA pLKO_005 3323 CDS 100% 13.200 18.480 N Cdon n/a
3 TRCN0000113555 CCGGAACAACAATAGGTGTTT pLKO.1 4315 CDS 100% 4.950 6.930 N Cdon n/a
4 TRCN0000113559 GATATGTTGTACCTCATCGTT pLKO.1 3875 CDS 100% 3.000 2.400 N Cdon n/a
5 TRCN0000412935 CATCAACAATGCACGTTATTA pLKO_005 1365 CDS 100% 15.000 10.500 N Cdon n/a
6 TRCN0000415014 CAAAGCTGAGGTGCGCTATAA pLKO_005 1441 CDS 100% 13.200 9.240 N CDON n/a
7 TRCN0000113558 CCGAATCTCATGGTTGCATAA pLKO.1 1168 CDS 100% 10.800 7.560 N Cdon n/a
8 TRCN0000113557 GCTGGGAAATATACTTGTGAA pLKO.1 2480 CDS 100% 4.950 3.465 N Cdon n/a
9 TRCN0000113556 GCTGTTCTCATCTGCACCATA pLKO.1 4107 CDS 100% 4.950 3.465 N Cdon n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510509.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.