Transcript: Mouse XM_006510539.1

PREDICTED: Mus musculus mitochondrial ribosomal protein L4 (Mrpl4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mrpl4 (66163)
Length:
1431
CDS:
337..1239

Additional Resources:

NCBI RefSeq record:
XM_006510539.1
NBCI Gene record:
Mrpl4 (66163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104282 CTCAAGATACACTCCGCTCTA pLKO.1 1185 CDS 100% 4.050 5.670 N Mrpl4 n/a
2 TRCN0000323837 CTCAAGATACACTCCGCTCTA pLKO_005 1185 CDS 100% 4.050 5.670 N Mrpl4 n/a
3 TRCN0000104281 CCGTGCTCCTTGTAGACTTAA pLKO.1 998 CDS 100% 13.200 10.560 N Mrpl4 n/a
4 TRCN0000104283 TCCTACAAGTTACTACTACAT pLKO.1 825 CDS 100% 4.950 3.465 N Mrpl4 n/a
5 TRCN0000353823 TCCTACAAGTTACTACTACAT pLKO_005 825 CDS 100% 4.950 3.465 N Mrpl4 n/a
6 TRCN0000104284 CCTGACAGAGTTGGCCCAGTA pLKO.1 960 CDS 100% 1.350 0.945 N Mrpl4 n/a
7 TRCN0000323904 CCTGACAGAGTTGGCCCAGTA pLKO_005 960 CDS 100% 1.350 0.945 N Mrpl4 n/a
8 TRCN0000104280 CCTGCCCTGGTCACCTAGGGA pLKO.1 1241 3UTR 100% 0.000 0.000 N Mrpl4 n/a
9 TRCN0000323905 CCTGCCCTGGTCACCTAGGGA pLKO_005 1241 3UTR 100% 0.000 0.000 N Mrpl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.