Transcript: Mouse XM_006510677.4

PREDICTED: Mus musculus myotubularin related protein 2 (Mtmr2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Mtmr2 (77116)
Length:
5922
CDS:
1858..3993

Additional Resources:

NCBI RefSeq record:
XM_006510677.4
NBCI Gene record:
Mtmr2 (77116)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510677.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030094 GCGAACAAGAAGATCCATATT pLKO.1 2568 CDS 100% 13.200 10.560 N Mtmr2 n/a
2 TRCN0000030098 GCTACTCCAATCATGTCCTTT pLKO.1 3734 CDS 100% 4.950 3.960 N Mtmr2 n/a
3 TRCN0000380304 AGAGCTCTGGGTGGGATATTA pLKO_005 3780 CDS 100% 15.000 10.500 N MTMR2 n/a
4 TRCN0000030095 CCATGTTATGAGAGAATCATT pLKO.1 3129 CDS 100% 5.625 3.938 N Mtmr2 n/a
5 TRCN0000030096 GCCAAAGATGTGACTTACATA pLKO.1 2323 CDS 100% 5.625 3.938 N Mtmr2 n/a
6 TRCN0000030097 GCCAGCTGGAAGACTTTACTA pLKO.1 3698 CDS 100% 5.625 3.938 N Mtmr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510677.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.