Transcript: Mouse XM_006510694.3

PREDICTED: Mus musculus neurexophilin and PC-esterase domain family, member 2 (Nxpe2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nxpe2 (78252)
Length:
1631
CDS:
90..1631

Additional Resources:

NCBI RefSeq record:
XM_006510694.3
NBCI Gene record:
Nxpe2 (78252)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510694.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183127 CACTTAAACAACCGCATCATT pLKO.1 96 CDS 100% 5.625 7.875 N Nxpe2 n/a
2 TRCN0000195965 CGCCTGAAAGCGTGATTGAAA pLKO.1 1576 CDS 100% 5.625 7.875 N Nxpe2 n/a
3 TRCN0000184225 GCCGTGTAACAACAAGACCAA pLKO.1 866 CDS 100% 2.640 3.696 N Nxpe2 n/a
4 TRCN0000437741 TGAATGCGGCCTCACCTTAAA pLKO_005 638 CDS 100% 13.200 10.560 N Nxpe2 n/a
5 TRCN0000434538 GAAGCATTCAGAACCTTATTA pLKO_005 1471 CDS 100% 15.000 10.500 N Nxpe2 n/a
6 TRCN0000216437 GAATGAGTTCAGGGCAATAAA pLKO.1 980 CDS 100% 15.000 10.500 N Nxpe2 n/a
7 TRCN0000442061 AGTGCGGAGCTGTGTCAATAT pLKO_005 663 CDS 100% 13.200 9.240 N Nxpe2 n/a
8 TRCN0000217218 CTGGATACTGAACGACATATT pLKO.1 1149 CDS 100% 13.200 9.240 N Nxpe2 n/a
9 TRCN0000425455 ATCCGCCTGAAAGCGTGATTG pLKO_005 1573 CDS 100% 10.800 7.560 N Nxpe2 n/a
10 TRCN0000184620 GCGCCAGTGGATTTACTACTT pLKO.1 1058 CDS 100% 4.950 3.465 N Nxpe2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510694.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.