Transcript: Mouse XM_006510713.3

PREDICTED: Mus musculus zinc finger protein 202 (Zfp202), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp202 (80902)
Length:
4603
CDS:
2030..3283

Additional Resources:

NCBI RefSeq record:
XM_006510713.3
NBCI Gene record:
Zfp202 (80902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510713.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281840 CCGTGTGGAGAAACCATATAC pLKO_005 2758 CDS 100% 13.200 18.480 N Zfp202 n/a
2 TRCN0000095828 CTCATCTTATTAGGCACTTAA pLKO.1 2568 CDS 100% 13.200 18.480 N Zfp202 n/a
3 TRCN0000271818 GGATAATACCAGTAGACTTAA pLKO_005 2419 CDS 100% 13.200 10.560 N Zfp202 n/a
4 TRCN0000271871 TCAGCAGAGGCTATCACTTAA pLKO_005 3222 CDS 100% 13.200 10.560 N Zfp202 n/a
5 TRCN0000281791 TAAGATGAACACTCCTCATAA pLKO_005 2680 CDS 100% 13.200 9.240 N Zfp202 n/a
6 TRCN0000281839 TCTGATAAGCGACCAACTTAA pLKO_005 3626 3UTR 100% 13.200 9.240 N Zfp202 n/a
7 TRCN0000095826 CGAGAAGCTCTCATCAGACTT pLKO.1 1542 5UTR 100% 4.950 3.465 N Zfp202 n/a
8 TRCN0000095827 GAAGGAGTTCTGATGGTGAAA pLKO.1 1407 5UTR 100% 4.950 3.465 N Zfp202 n/a
9 TRCN0000095825 CGAGAACTTCAGTGAGCAGAA pLKO.1 2962 CDS 100% 4.050 2.835 N Zfp202 n/a
10 TRCN0000095824 GCACTGTATCTAGTGCAGAAT pLKO.1 4164 3UTR 100% 0.495 0.347 N Zfp202 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510713.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.