Transcript: Mouse XM_006510748.1

PREDICTED: Mus musculus plastin 1 (I-isoform) (Pls1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pls1 (102502)
Length:
3619
CDS:
304..1959

Additional Resources:

NCBI RefSeq record:
XM_006510748.1
NBCI Gene record:
Pls1 (102502)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090348 CCAGCCGTTAAGTATTTATTT pLKO.1 2790 3UTR 100% 15.000 21.000 N Pls1 n/a
2 TRCN0000090350 CCCGTACATCAATCACCTGTA pLKO.1 1302 CDS 100% 4.050 5.670 N Pls1 n/a
3 TRCN0000090351 CCAGGACATCAAGGATTCAAA pLKO.1 942 CDS 100% 5.625 3.938 N Pls1 n/a
4 TRCN0000090352 CAGTGGATATGTTAGTGACTA pLKO.1 147 5UTR 100% 4.950 3.465 N Pls1 n/a
5 TRCN0000090349 GCTGGATTTATGCTCCAGGAA pLKO.1 1072 CDS 100% 0.264 0.185 N Pls1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.