Transcript: Mouse XM_006510797.3

PREDICTED: Mus musculus collagen, type XII, alpha 1 (Col12a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Col12a1 (12816)
Length:
11420
CDS:
1217..10579

Additional Resources:

NCBI RefSeq record:
XM_006510797.3
NBCI Gene record:
Col12a1 (12816)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510797.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091114 GCACCGACTAACTTAGTAATT pLKO.1 5375 CDS 100% 13.200 18.480 N Col12a1 n/a
2 TRCN0000335320 GCACCGACTAACTTAGTAATT pLKO_005 5375 CDS 100% 13.200 18.480 N Col12a1 n/a
3 TRCN0000091116 CGGATTAGATACAGACCAGTT pLKO.1 3476 CDS 100% 4.050 5.670 N Col12a1 n/a
4 TRCN0000335319 CGGATTAGATACAGACCAGTT pLKO_005 3476 CDS 100% 4.050 5.670 N Col12a1 n/a
5 TRCN0000091115 CCAGGCTTTAAGATGCTTGAA pLKO.1 8777 CDS 100% 4.950 3.465 N Col12a1 n/a
6 TRCN0000091117 GCTGGAAATATAACAACTGAT pLKO.1 9251 CDS 100% 4.950 3.465 N Col12a1 n/a
7 TRCN0000335258 GCTGGAAATATAACAACTGAT pLKO_005 9251 CDS 100% 4.950 3.465 N Col12a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510797.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.