Transcript: Mouse XM_006510843.3

PREDICTED: Mus musculus neogenin (Neo1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Neo1 (18007)
Length:
7905
CDS:
1035..5465

Additional Resources:

NCBI RefSeq record:
XM_006510843.3
NBCI Gene record:
Neo1 (18007)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510843.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305538 GGACTATAAACAACGTTATTA pLKO_005 3488 CDS 100% 15.000 21.000 N Neo1 n/a
2 TRCN0000109662 CCCAGCAAACACGAAGTACAA pLKO.1 3776 CDS 100% 4.950 6.930 N Neo1 n/a
3 TRCN0000305539 GGATGATGCTGGGACTTATTT pLKO_005 2003 CDS 100% 15.000 12.000 N Neo1 n/a
4 TRCN0000109661 CCCTCGAAACTCTCAAGATAT pLKO.1 4649 CDS 100% 13.200 9.240 N Neo1 n/a
5 TRCN0000305583 CTACTCCCAGATGGATCTTTA pLKO_005 1374 CDS 100% 13.200 9.240 N Neo1 n/a
6 TRCN0000109664 GCTATTTGGTTACTGGTTTAA pLKO.1 3820 CDS 100% 13.200 9.240 N Neo1 n/a
7 TRCN0000305584 AGTGTAGACATTGGCATTTAT pLKO_005 5815 3UTR 100% 15.000 9.000 N Neo1 n/a
8 TRCN0000109663 CCTCAGAATCTGTCCTTAGAA pLKO.1 3036 CDS 100% 5.625 3.375 N Neo1 n/a
9 TRCN0000332125 CCTCAGAATCTGTCCTTAGAA pLKO_005 3036 CDS 100% 5.625 3.375 N Neo1 n/a
10 TRCN0000109660 GCTTGTGTCTTTGTGCTGCAA pLKO.1 5777 3UTR 100% 2.640 1.584 N Neo1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510843.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.