Transcript: Mouse XM_006510932.4

PREDICTED: Mus musculus unc-13 homolog C (Unc13c), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Unc13c (208898)
Length:
9095
CDS:
991..7647

Additional Resources:

NCBI RefSeq record:
XM_006510932.4
NBCI Gene record:
Unc13c (208898)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510932.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028216 CCACGATTACATTAAACACTT pLKO.1 1896 CDS 100% 4.950 6.930 N Unc13c n/a
2 TRCN0000028247 GCTCGAATAGTAAGTGGCAAT pLKO.1 3985 CDS 100% 4.050 5.670 N Unc13c n/a
3 TRCN0000027757 GCTCAGCTTAACCAGAGCTTT pLKO.1 6184 CDS 100% 4.950 3.960 N LOC235480 n/a
4 TRCN0000027685 GCCCGAGAAGATCGAATAATT pLKO.1 7429 CDS 100% 15.000 10.500 N LOC235480 n/a
5 TRCN0000027758 GCTCTGGAAATTAGTACTTAA pLKO.1 6756 CDS 100% 13.200 9.240 N LOC235480 n/a
6 TRCN0000028236 CCCATCCTAGTGTACTTTGAA pLKO.1 2107 CDS 100% 5.625 3.938 N Unc13c n/a
7 TRCN0000027720 CTAAAGAGTTTGTGAGACTTA pLKO.1 7592 CDS 100% 4.950 3.465 N LOC235480 n/a
8 TRCN0000028262 GCCAATTCTAATGACCTGTAT pLKO.1 3208 CDS 100% 4.950 3.465 N Unc13c n/a
9 TRCN0000027762 GCCTTGCATATTGATGAACAA pLKO.1 6351 CDS 100% 4.950 3.465 N LOC235480 n/a
10 TRCN0000028215 CCAGACTATCATCACAGCCAT pLKO.1 4464 CDS 100% 2.640 1.848 N Unc13c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510932.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.