Transcript: Mouse XM_006511007.3

PREDICTED: Mus musculus zinc finger protein 609 (Zfp609), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp609 (214812)
Length:
7871
CDS:
195..3749

Additional Resources:

NCBI RefSeq record:
XM_006511007.3
NBCI Gene record:
Zfp609 (214812)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511007.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241655 AGCAAGCGTGTCCGTACAAAT pLKO_005 885 CDS 100% 13.200 18.480 N Zfp609 n/a
2 TRCN0000244336 GTTAGTGCCAGTGGTCAATAA pLKO_005 299 CDS 100% 13.200 18.480 N Zfp609 n/a
3 TRCN0000241657 TGAGTACCAACACCGCTTATC pLKO_005 2488 CDS 100% 10.800 15.120 N Zfp609 n/a
4 TRCN0000219873 GAGCAAGTCTCCCACGATAAG pLKO.1 3443 CDS 100% 10.800 8.640 N ZNF609 n/a
5 TRCN0000241658 CTCCCGTGGTTACCCTATTAT pLKO_005 7627 3UTR 100% 15.000 10.500 N Zfp609 n/a
6 TRCN0000173945 GAGAGCGTAGAAGGGAAAGTA pLKO.1 2301 CDS 100% 5.625 3.938 N Zfp609 n/a
7 TRCN0000173770 CTGGACATCTTGCAGCAACAT pLKO.1 3408 CDS 100% 4.950 3.465 N Zfp609 n/a
8 TRCN0000194563 CCCAGATGAAGTCAGCTTCAT pLKO.1 3766 3UTR 100% 0.495 0.347 N Zfp609 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511007.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.