Transcript: Mouse XM_006511104.2

PREDICTED: Mus musculus HECT and RLD domain containing E3 ubiquitin protein ligase family member 1 (Herc1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Herc1 (235439)
Length:
15295
CDS:
192..14846

Additional Resources:

NCBI RefSeq record:
XM_006511104.2
NBCI Gene record:
Herc1 (235439)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511104.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087440 GCGCAGTTTCCAGAGTCATTT pLKO.1 12090 CDS 100% 13.200 10.560 N Herc1 n/a
2 TRCN0000087442 GCTTATCACAAGTCACAACAT pLKO.1 853 CDS 100% 4.950 3.960 N Herc1 n/a
3 TRCN0000087441 GCCATCACTACTGGAACTTAT pLKO.1 5685 CDS 100% 13.200 9.240 N Herc1 n/a
4 TRCN0000087438 GCTTAAAGAAAGTCCTTGGAA pLKO.1 3299 CDS 100% 3.000 2.100 N Herc1 n/a
5 TRCN0000087439 GCCTGGCATCAAATACTCCAA pLKO.1 10024 CDS 100% 2.640 1.848 N Herc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511104.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.