Transcript: Mouse XM_006511134.2

PREDICTED: Mus musculus glycerol kinase 5 (putative) (Gk5), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gk5 (235533)
Length:
6930
CDS:
102..1397

Additional Resources:

NCBI RefSeq record:
XM_006511134.2
NBCI Gene record:
Gk5 (235533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511134.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362140 CTTCCTACGCCACGGATTATT pLKO_005 430 CDS 100% 15.000 21.000 N Gk5 n/a
2 TRCN0000024831 CCGAGCAATATTGGAGTCAAT pLKO.1 1025 CDS 100% 4.950 6.930 N Gk5 n/a
3 TRCN0000024832 GCTGTTATACAAGCTCACGAA pLKO.1 404 CDS 100% 2.640 3.696 N Gk5 n/a
4 TRCN0000377598 TGGATTACAGGCTCCATTAAA pLKO_005 941 CDS 100% 15.000 10.500 N GK5 n/a
5 TRCN0000024833 GACCTGATAAATGAGAAGATA pLKO.1 1164 CDS 100% 5.625 3.938 N Gk5 n/a
6 TRCN0000362141 TGAAGGATACCAGCTATAATT pLKO_005 550 CDS 100% 15.000 9.000 N Gk5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511134.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.