Transcript: Mouse XM_006511455.2

PREDICTED: Mus musculus RNA binding protein with multiple splicing 2 (Rbpms2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbpms2 (71973)
Length:
1952
CDS:
226..846

Additional Resources:

NCBI RefSeq record:
XM_006511455.2
NBCI Gene record:
Rbpms2 (71973)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198524 GCAAACTAATAGCGACACCAA pLKO.1 551 CDS 100% 2.640 3.696 N Rbpms2 n/a
2 TRCN0000200024 CGTCCATTCAAGGGCTATGAA pLKO.1 361 CDS 100% 5.625 3.938 N Rbpms2 n/a
3 TRCN0000340423 CTACCTGCTCTTCCGTCCATT pLKO_005 348 CDS 100% 4.950 3.465 N Rbpms2 n/a
4 TRCN0000177039 GTGGATATTAAACCTAGAGAA pLKO.1 325 CDS 100% 4.950 3.465 N Rbpms2 n/a
5 TRCN0000340346 GTGGATATTAAACCTAGAGAA pLKO_005 325 CDS 100% 4.950 3.465 N Rbpms2 n/a
6 TRCN0000340444 ATGAAGGGTCCCTGATCAAGC pLKO_005 377 CDS 100% 4.050 2.835 N Rbpms2 n/a
7 TRCN0000340424 AGGAGGTCCGCACACTGTTTG pLKO_005 290 CDS 100% 3.600 2.520 N Rbpms2 n/a
8 TRCN0000181706 GCATGTCTGTGCTTTACCTTT pLKO.1 1796 3UTR 100% 4.950 2.970 N Rbpms2 n/a
9 TRCN0000340422 GCATGTCTGTGCTTTACCTTT pLKO_005 1796 3UTR 100% 4.950 2.970 N Rbpms2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.