Transcript: Mouse XM_006511474.3

PREDICTED: Mus musculus DAZ interacting protein 1-like (Dzip1l), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Dzip1l (72507)
Length:
4949
CDS:
357..2681

Additional Resources:

NCBI RefSeq record:
XM_006511474.3
NBCI Gene record:
Dzip1l (72507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511474.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216917 CTACCTCTGACCAAGTAATTC pLKO.1 3386 3UTR 100% 13.200 10.560 N Dzip1l n/a
2 TRCN0000437750 GGAACACTGGTGCAGTCAATT pLKO_005 2376 CDS 100% 13.200 10.560 N Dzip1l n/a
3 TRCN0000176437 CAATATGTTCTTAAGGCCCAA pLKO.1 2453 CDS 100% 2.160 1.728 N Dzip1l n/a
4 TRCN0000216433 GTTGTGACAAATGGATATTTA pLKO.1 3630 3UTR 100% 15.000 10.500 N Dzip1l n/a
5 TRCN0000174038 CAGCGGGAAATGGAAGCTAAA pLKO.1 1080 CDS 100% 10.800 7.560 N Dzip1l n/a
6 TRCN0000418193 GACGTGGAGATCTCGTCTTTG pLKO_005 2535 CDS 100% 10.800 7.560 N Dzip1l n/a
7 TRCN0000437884 GAGACAGACAGAACCTCTATC pLKO_005 2809 3UTR 100% 10.800 7.560 N Dzip1l n/a
8 TRCN0000194507 GACAAGCTGAAACAGCTGTTT pLKO.1 1155 CDS 100% 4.950 3.465 N Dzip1l n/a
9 TRCN0000173781 CAAGAGGGACACAAAGGGAAT pLKO.1 1778 CDS 100% 4.050 2.835 N Dzip1l n/a
10 TRCN0000173436 CCACGTTAGAAGAGAAACTGA pLKO.1 1210 CDS 100% 3.000 2.100 N Dzip1l n/a
11 TRCN0000173899 GCCAGGCATAGTAATCGAGTA pLKO.1 3111 3UTR 100% 4.050 5.265 N Dzip1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511474.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.