Transcript: Mouse XM_006511533.3

PREDICTED: Mus musculus C2 calcium-dependent domain containing 4B (C2cd4b), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
C2cd4b (75697)
Length:
1268
CDS:
59..1081

Additional Resources:

NCBI RefSeq record:
XM_006511533.3
NBCI Gene record:
C2cd4b (75697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511533.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267174 GCGAAGACAGTGACGAAGACT pLKO_005 258 CDS 100% 3.000 4.200 N C2cd4b n/a
2 TRCN0000267177 CCTGGTGCTCTGGACATTTAA pLKO_005 1092 3UTR 100% 15.000 10.500 N C2cd4b n/a
3 TRCN0000267176 CTGCCTTCTCCAACGTGCTCA pLKO_005 99 CDS 100% 0.880 0.616 N C2cd4b n/a
4 TRCN0000267178 ACCAGGACTGCTGCTTCGATC pLKO_005 933 CDS 100% 1.350 0.810 N C2cd4b n/a
5 TRCN0000267175 TGGGCTCTCTGCTACTGCTAT pLKO_005 1059 CDS 100% 4.950 2.475 Y C2cd4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511533.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.