Transcript: Mouse XM_006511561.3

PREDICTED: Mus musculus lactamase, beta (Lactb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lactb (80907)
Length:
1866
CDS:
84..1154

Additional Resources:

NCBI RefSeq record:
XM_006511561.3
NBCI Gene record:
Lactb (80907)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511561.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313301 TACGTGGATAACTCCTATAAA pLKO_005 1091 CDS 100% 15.000 21.000 N Lactb n/a
2 TRCN0000349949 TTGACGTTCCCAAATACATAA pLKO_005 1622 3UTR 100% 13.200 18.480 N Lactb n/a
3 TRCN0000046625 CCTTACGTGGATAACTCCTAT pLKO.1 1088 CDS 100% 4.950 6.930 N LACTB n/a
4 TRCN0000221955 GCTACCAAGTTGGGCAGTTTA pLKO.1 1179 3UTR 100% 13.200 10.560 N Lactb n/a
5 TRCN0000313363 TGGACTCAGAGGCCGTAAATA pLKO_005 1437 3UTR 100% 15.000 10.500 N Lactb n/a
6 TRCN0000221953 CCCAAATACATAAACCCTTTA pLKO.1 1630 3UTR 100% 10.800 7.560 N Lactb n/a
7 TRCN0000221957 CTGTCACAACAAGATTACTAA pLKO.1 697 CDS 100% 5.625 3.938 N Lactb n/a
8 TRCN0000312337 CTGTCACAACAAGATTACTAA pLKO_005 697 CDS 100% 5.625 3.938 N Lactb n/a
9 TRCN0000221956 GCTTTGAAGATCGCTCTGGAA pLKO.1 1529 3UTR 100% 2.640 1.848 N Lactb n/a
10 TRCN0000312338 GCTTTGAAGATCGCTCTGGAA pLKO_005 1529 3UTR 100% 2.640 1.848 N Lactb n/a
11 TRCN0000221954 GCCAGAAACAATGGTGATGAT pLKO.1 1237 3UTR 100% 4.950 2.970 N Lactb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511561.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.