Transcript: Mouse XM_006511660.3

PREDICTED: Mus musculus ribosomal protein L29 (Rpl29), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rpl29 (19944)
Length:
1641
CDS:
1040..1522

Additional Resources:

NCBI RefSeq record:
XM_006511660.3
NBCI Gene record:
Rpl29 (19944)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511660.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104155 GCCAAGAAGCACAACAAGAAA pLKO.1 1175 CDS 100% 5.625 2.813 Y Rpl29 n/a
2 TRCN0000334951 GCCAAGAAGCACAACAAGAAA pLKO_005 1175 CDS 100% 5.625 2.813 Y Rpl29 n/a
3 TRCN0000104156 CGCAAAGATACGAATCTCTTA pLKO.1 1116 CDS 100% 4.950 2.475 Y Rpl29 n/a
4 TRCN0000335022 CGCAAAGATACGAATCTCTTA pLKO_005 1116 CDS 100% 4.950 2.475 Y Rpl29 n/a
5 TRCN0000104157 GCACAGAAATGGCATCAAGAA pLKO.1 1087 CDS 100% 4.950 2.475 Y Rpl29 n/a
6 TRCN0000334949 GCACAGAAATGGCATCAAGAA pLKO_005 1087 CDS 100% 4.950 2.475 Y Rpl29 n/a
7 TRCN0000104158 GCACAACAAGAAAGGCCTGAA pLKO.1 1183 CDS 100% 4.050 2.025 Y Rpl29 n/a
8 TRCN0000335023 GCACAACAAGAAAGGCCTGAA pLKO_005 1183 CDS 100% 4.050 2.025 Y Rpl29 n/a
9 TRCN0000104159 GAAGCCTAAGGTCCAAACCAA pLKO.1 1396 CDS 100% 3.000 1.500 Y Rpl29 n/a
10 TRCN0000335024 GAAGCCTAAGGTCCAAACCAA pLKO_005 1396 CDS 100% 3.000 1.500 Y Rpl29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511660.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.