Transcript: Mouse XM_006511869.3

PREDICTED: Mus musculus transmembrane protein 108 (Tmem108), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem108 (81907)
Length:
3952
CDS:
512..2236

Additional Resources:

NCBI RefSeq record:
XM_006511869.3
NBCI Gene record:
Tmem108 (81907)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191220 CTTCCAAATCTACAAGGGTAA pLKO.1 1159 CDS 100% 4.050 2.835 N Tmem108 n/a
2 TRCN0000202324 GCCAGGCTTTATCAGATCCAA pLKO.1 1342 CDS 100% 3.000 2.100 N Tmem108 n/a
3 TRCN0000202353 GAACAACCTGAGCTACTGGAA pLKO.1 2014 CDS 100% 2.640 1.848 N Tmem108 n/a
4 TRCN0000144114 CTTTGTGTAACCCTGACTTAA pLKO.1 2317 3UTR 100% 13.200 7.920 N TMEM108 n/a
5 TRCN0000140915 CAACCTGAGCTACTGGAACAA pLKO.1 2017 CDS 100% 4.950 2.970 N TMEM108 n/a
6 TRCN0000192303 CCATCACAATGGACTACTTCA pLKO.1 2040 CDS 100% 4.950 2.970 N Tmem108 n/a
7 TRCN0000121789 CCTTTGTGTAACCCTGACTTA pLKO.1 2316 3UTR 100% 4.950 2.970 N TMEM108 n/a
8 TRCN0000193003 GCTACTCTGGAAACTACAGTA pLKO.1 746 CDS 100% 4.950 2.970 N Tmem108 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.