Transcript: Mouse XM_006511917.3

PREDICTED: Mus musculus solute carrier family 22 (organic cation transporter), member 13 (Slc22a13), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc22a13 (102570)
Length:
1610
CDS:
72..1295

Additional Resources:

NCBI RefSeq record:
XM_006511917.3
NBCI Gene record:
Slc22a13 (102570)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511917.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070321 ACCCGTCTTACTGCTCTTCTT pLKO.1 416 CDS 100% 4.950 3.960 N Slc22a13 n/a
2 TRCN0000070322 TGCTTCTGTCAGGCATCACAA pLKO.1 154 CDS 100% 4.950 3.465 N Slc22a13 n/a
3 TRCN0000070319 CCCTACGCTTTGTCTTGGCTA pLKO.1 217 CDS 100% 2.640 1.848 N Slc22a13 n/a
4 TRCN0000102147 GCGATTCCCATGGTCATCTTT pLKO.1 1074 CDS 100% 5.625 2.813 Y Slc22a13b-ps n/a
5 TRCN0000102146 GCTGGCATCATGTACATCATT pLKO.1 837 CDS 100% 5.625 2.813 Y Slc22a13b-ps n/a
6 TRCN0000102148 CTTCACCATCTCCTATGTGTA pLKO.1 935 CDS 100% 4.950 2.475 Y Slc22a13b-ps n/a
7 TRCN0000102149 CTGATATTTGGAGCAGTGGAA pLKO.1 738 CDS 100% 2.640 1.320 Y Slc22a13b-ps n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511917.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.