Transcript: Mouse XM_006511921.2

PREDICTED: Mus musculus CUB domain containing protein 1 (Cdcp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdcp1 (109332)
Length:
5412
CDS:
216..2714

Additional Resources:

NCBI RefSeq record:
XM_006511921.2
NBCI Gene record:
Cdcp1 (109332)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126678 TGTGGGTATCTATAATGGCAA pLKO.1 2315 CDS 100% 2.640 3.696 N Cdcp1 n/a
2 TRCN0000126677 CGTCATGTCTAGACAGCATAT pLKO.1 386 CDS 100% 10.800 7.560 N Cdcp1 n/a
3 TRCN0000126675 CCTCAACTTCAATGTCTCCAA pLKO.1 1010 CDS 100% 2.640 1.848 N Cdcp1 n/a
4 TRCN0000126676 CCTGGTACTCATCATCTGCTT pLKO.1 2258 CDS 100% 2.640 1.848 N Cdcp1 n/a
5 TRCN0000126674 CCATCAAGTATGCAGTGAATT pLKO.1 3341 3UTR 100% 0.000 0.000 N Cdcp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.