Transcript: Mouse XM_006511984.2

PREDICTED: Mus musculus phospholipase C, delta 1 (Plcd1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plcd1 (18799)
Length:
2744
CDS:
373..2469

Additional Resources:

NCBI RefSeq record:
XM_006511984.2
NBCI Gene record:
Plcd1 (18799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222645 GCCGTCAGACAGCAGTTATTA pLKO.1 2204 CDS 100% 15.000 21.000 N Plcd1 n/a
2 TRCN0000351808 GCCGTCAGACAGCAGTTATTA pLKO_005 2204 CDS 100% 15.000 21.000 N Plcd1 n/a
3 TRCN0000076927 CCTCCTCTAAGAACGACTTTA pLKO.1 2324 CDS 100% 13.200 9.240 N Plcd1 n/a
4 TRCN0000351809 CCTCCTCTAAGAACGACTTTA pLKO_005 2324 CDS 100% 13.200 9.240 N Plcd1 n/a
5 TRCN0000076926 CTCCTCTAAGAACGACTTTAT pLKO.1 2325 CDS 100% 13.200 9.240 N Plcd1 n/a
6 TRCN0000076924 GCCACTACTTAGTGTCTTCTT pLKO.1 1106 CDS 100% 4.950 3.465 N Plcd1 n/a
7 TRCN0000351807 GCCACTACTTAGTGTCTTCTT pLKO_005 1106 CDS 100% 4.950 3.465 N Plcd1 n/a
8 TRCN0000222646 GCGGAGCTTGAGGCCACTGAA pLKO.1 2547 3UTR 100% 0.000 0.000 N Plcd1 n/a
9 TRCN0000351727 GCGGAGCTTGAGGCCACTGAA pLKO_005 2547 3UTR 100% 0.000 0.000 N Plcd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.