Transcript: Mouse XM_006511997.1

PREDICTED: Mus musculus sodium channel, voltage-gated, type V, alpha (Scn5a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scn5a (20271)
Length:
8473
CDS:
237..6299

Additional Resources:

NCBI RefSeq record:
XM_006511997.1
NBCI Gene record:
Scn5a (20271)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069004 CCAGGGTTTCATATTCGACAT pLKO.1 4796 CDS 100% 4.050 5.670 N Scn5a n/a
2 TRCN0000453462 GAACAAGCTTTCATAGGTTTA pLKO_005 6600 3UTR 100% 10.800 7.560 N Scn5a n/a
3 TRCN0000069005 GCCAATTACCTACTCAAGAAT pLKO.1 1170 CDS 100% 5.625 3.938 N Scn5a n/a
4 TRCN0000069007 CCTTGACCCATACTACTACTT pLKO.1 2546 CDS 100% 4.950 3.465 N Scn5a n/a
5 TRCN0000069003 GCCGACAAGATGTTCACCTAT pLKO.1 3969 CDS 100% 4.950 3.465 N Scn5a n/a
6 TRCN0000069006 CCCTTTCTATAGTACCCAGAA pLKO.1 488 CDS 100% 4.050 2.835 N Scn5a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.