Transcript: Mouse XM_006512035.1

PREDICTED: Mus musculus cysteine-serine-rich nuclear protein 1 (Csrnp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csrnp1 (215418)
Length:
4032
CDS:
1123..2955

Additional Resources:

NCBI RefSeq record:
XM_006512035.1
NBCI Gene record:
Csrnp1 (215418)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247191 GGCATCACCGTCTACTATTTC pLKO_005 1465 CDS 100% 13.200 18.480 N Csrnp1 n/a
2 TRCN0000247190 TGTGCCAGTGTAAGGATTAAG pLKO_005 2943 CDS 100% 13.200 10.560 N Csrnp1 n/a
3 TRCN0000247192 GTGACTCTGACCTCGGAATTG pLKO_005 2381 CDS 100% 10.800 8.640 N Csrnp1 n/a
4 TRCN0000247193 AGTTTATGGCTGCTCTATTAA pLKO_005 3514 3UTR 100% 15.000 10.500 N Csrnp1 n/a
5 TRCN0000215519 GTTTATGGCTGCTCTATTAAA pLKO.1 3515 3UTR 100% 15.000 10.500 N Csrnp1 n/a
6 TRCN0000257631 TCCAGGCTCTGCCAGATTATA pLKO_005 2711 CDS 100% 15.000 10.500 N Csrnp1 n/a
7 TRCN0000217221 CTGTGCCAGTGTAAGGATTAA pLKO.1 2942 CDS 100% 13.200 9.240 N Csrnp1 n/a
8 TRCN0000173231 CCTGAATTTCAGTGACTCTGA pLKO.1 2370 CDS 100% 2.640 1.848 N Csrnp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.