Transcript: Mouse XM_006512044.3

PREDICTED: Mus musculus SEC22 homolog C, vesicle trafficking protein (Sec22c), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec22c (215474)
Length:
4210
CDS:
305..1180

Additional Resources:

NCBI RefSeq record:
XM_006512044.3
NBCI Gene record:
Sec22c (215474)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512044.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124998 CCTTACGCCTTTCTTGAGTTT pLKO.1 629 CDS 100% 4.950 6.930 N Sec22c n/a
2 TRCN0000124997 CGCAGAGCATTCTTTACAGGT pLKO.1 931 CDS 100% 2.640 3.696 N Sec22c n/a
3 TRCN0000124994 CCAGGGTTTCAGAGATCCTTA pLKO.1 1990 3UTR 100% 4.950 3.465 N Sec22c n/a
4 TRCN0000124995 CGGAAAGTTGTGACTTCCTTA pLKO.1 462 CDS 100% 4.950 3.465 N Sec22c n/a
5 TRCN0000124996 GCAGAGCATTCTTTACAGGTT pLKO.1 932 CDS 100% 2.640 1.848 N Sec22c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512044.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.