Transcript: Mouse XM_006512066.3

PREDICTED: Mus musculus villin-like (Vill), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vill (22351)
Length:
1741
CDS:
217..1662

Additional Resources:

NCBI RefSeq record:
XM_006512066.3
NBCI Gene record:
Vill (22351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512066.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446495 GCAGTGACTCAATGGTCAATG pLKO_005 1451 CDS 100% 10.800 8.640 N Vill n/a
2 TRCN0000439381 GTGCCACATACCCTGAAATTC pLKO_005 1676 3UTR 100% 13.200 9.240 N Vill n/a
3 TRCN0000092000 GACAAGTATGACATCATGTTA pLKO.1 976 CDS 100% 5.625 3.938 N Vill n/a
4 TRCN0000092002 GCTACCTTGTCCTCTACACAT pLKO.1 320 CDS 100% 4.950 3.465 N Vill n/a
5 TRCN0000091999 GTGTGGTACATCCAGGACTTA pLKO.1 247 CDS 100% 4.950 3.465 N Vill n/a
6 TRCN0000092001 CGTAAGGAGTTCTATCTCTCA pLKO.1 1540 CDS 100% 2.640 1.848 N Vill n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512066.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.