Transcript: Mouse XM_006512181.2

PREDICTED: Mus musculus F-box and WD-40 domain protein 22 (Fbxw22), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxw22 (382156)
Length:
1463
CDS:
18..1379

Additional Resources:

NCBI RefSeq record:
XM_006512181.2
NBCI Gene record:
Fbxw22 (382156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270147 CACCTTTCATCCTGACTAAAG pLKO_005 1365 CDS 100% 10.800 7.560 N Fbxw22 n/a
2 TRCN0000270085 GGGAAGTTCTGGCAACTAAAG pLKO_005 556 CDS 100% 10.800 6.480 N Fbxw22 n/a
3 TRCN0000270084 GTACAGCCCTCCTATATCATG pLKO_005 453 CDS 100% 4.950 2.970 N Fbxw22 n/a
4 TRCN0000253976 ATCGGGAACAAAGTAACTATT pLKO_005 984 CDS 100% 13.200 6.600 Y Fbxw14 n/a
5 TRCN0000192570 GCCAGAAGATTTCACTTACAA pLKO.1 269 CDS 100% 5.625 2.813 Y Fbxw20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.