Transcript: Mouse XM_006512794.3

PREDICTED: Mus musculus A kinase (PRKA) anchor protein 7 (Akap7), transcript variant X14, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Akap7 (432442)
Length:
1892
CDS:
87..785

Additional Resources:

NCBI RefSeq record:
XM_006512794.3
NBCI Gene record:
Akap7 (432442)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512794.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193362 CCTGGATTGTATGAACAATTT pLKO.1 450 CDS 100% 1.320 1.056 N Akap7 n/a
2 TRCN0000193554 GAACTATTGTACCAGATAGAT pLKO.1 492 CDS 100% 5.625 3.938 N Akap7 n/a
3 TRCN0000193636 CGGCTCCTTTCATATTACCTT pLKO.1 98 CDS 100% 3.000 2.100 N Akap7 n/a
4 TRCN0000175724 GACCTTTATGAAGCTGTCCAA pLKO.1 389 CDS 100% 2.640 1.848 N Akap7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512794.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.