Transcript: Mouse XM_006512798.3

PREDICTED: Mus musculus Abelson helper integration site 1 (Ahi1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ahi1 (52906)
Length:
4881
CDS:
422..3538

Additional Resources:

NCBI RefSeq record:
XM_006512798.3
NBCI Gene record:
Ahi1 (52906)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512798.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340742 CGAGACGGATATCCGATTATA pLKO_005 1862 CDS 100% 15.000 21.000 N Ahi1 n/a
2 TRCN0000192100 CGAGCCGATTCTTCTTTATAT pLKO.1 2701 CDS 100% 15.000 21.000 N Ahi1 n/a
3 TRCN0000352458 GTGCGCCACTGGACGATAAAT pLKO_005 2321 CDS 100% 15.000 21.000 N Ahi1 n/a
4 TRCN0000202060 CCAGCCGATCAGATGAACTAA pLKO.1 3138 CDS 100% 5.625 7.875 N Ahi1 n/a
5 TRCN0000190390 CCCTATTTGCTTCGAGAGTTT pLKO.1 1262 CDS 100% 4.950 6.930 N Ahi1 n/a
6 TRCN0000340740 CCCTATTTGCTTCGAGAGTTT pLKO_005 1262 CDS 100% 4.950 6.930 N Ahi1 n/a
7 TRCN0000201363 GCTGAAATGTTGAAACGCTAT pLKO.1 2750 CDS 100% 4.050 5.670 N Ahi1 n/a
8 TRCN0000340741 GGACTATATTCTCCCTATTAT pLKO_005 1162 CDS 100% 15.000 12.000 N Ahi1 n/a
9 TRCN0000191207 CCGAGTGTATTTCAAAGATAA pLKO.1 3181 CDS 100% 13.200 9.240 N Ahi1 n/a
10 TRCN0000352530 CTAAGTAGCTGCTGGATATTG pLKO_005 3989 3UTR 100% 13.200 9.240 N Ahi1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512798.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.