Transcript: Mouse XM_006512854.4

PREDICTED: Mus musculus prenyl (solanesyl) diphosphate synthase, subunit 2 (Pdss2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pdss2 (71365)
Length:
5059
CDS:
3515..4414

Additional Resources:

NCBI RefSeq record:
XM_006512854.4
NBCI Gene record:
Pdss2 (71365)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512854.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253053 GAGCGACGAGCTCAGCAATAT pLKO_005 3736 CDS 100% 13.200 9.240 N Pdss2 n/a
2 TRCN0000157991 CCTGTGTCGTTACCATGGAAA pLKO.1 4303 CDS 100% 4.950 3.465 N PDSS2 n/a
3 TRCN0000156980 CCTCAGCAAATGGACAGGAAA pLKO.1 4693 3UTR 100% 4.950 2.970 N PDSS2 n/a
4 TRCN0000156683 GCTATCCTGAGTGGAGACTTT pLKO.1 4079 CDS 100% 4.950 3.465 N PDSS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512854.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.