Transcript: Mouse XM_006512967.3

PREDICTED: Mus musculus calcium channel, voltage-dependent, beta subunit associated regulatory protein (Cbarp), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cbarp (100503659)
Length:
3238
CDS:
349..2499

Additional Resources:

NCBI RefSeq record:
XM_006512967.3
NBCI Gene record:
Cbarp (100503659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512967.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342106 CCGACTTCATTCAGTACATTG pLKO_005 1433 CDS 100% 10.800 15.120 N Cbarp n/a
2 TRCN0000201855 GCCGACTTCATTCAGTACATT pLKO.1 1432 CDS 100% 5.625 7.875 N Cbarp n/a
3 TRCN0000192191 CCTACTTCAAGGTCAAGAAAT pLKO.1 1289 CDS 100% 13.200 9.240 N Cbarp n/a
4 TRCN0000352657 GGACTCTCCGGTCCATATATG pLKO_005 2722 3UTR 100% 13.200 9.240 N Cbarp n/a
5 TRCN0000342105 ACGAGAAGACGGACGCTCTTT pLKO_005 2018 CDS 100% 4.950 3.465 N Cbarp n/a
6 TRCN0000189591 CCATGCCGACTTCATTCAGTA pLKO.1 1428 CDS 100% 4.950 3.465 N Cbarp n/a
7 TRCN0000190448 GCTTCAAGTTTCCCAAGCTTT pLKO.1 3106 3UTR 100% 4.950 3.465 N Cbarp n/a
8 TRCN0000192032 CTTCAAGGTCAAGAAATGGAA pLKO.1 1293 CDS 100% 3.000 2.100 N Cbarp n/a
9 TRCN0000342171 CTTCAAGGTCAAGAAATGGAA pLKO_005 1293 CDS 100% 3.000 2.100 N Cbarp n/a
10 TRCN0000342107 TCATCCCAGGTGCTGATTGTC pLKO_005 2437 CDS 100% 4.950 2.970 N Cbarp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512967.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.