Transcript: Mouse XM_006513139.3

PREDICTED: Mus musculus ankyrin 3, epithelial (Ank3), transcript variant X44, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ank3 (11735)
Length:
8128
CDS:
1382..4663

Additional Resources:

NCBI RefSeq record:
XM_006513139.3
NBCI Gene record:
Ank3 (11735)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513139.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236778 CGGATAAGCTAGTCGATTATT pLKO_005 6175 3UTR 100% 15.000 21.000 N Ank3 n/a
2 TRCN0000236780 TGCCGTGGTTTCCCGGATTAA pLKO_005 2185 CDS 100% 13.200 18.480 N Ank3 n/a
3 TRCN0000236777 TTCGGTCTTAACGAAGATTAA pLKO_005 3409 CDS 100% 13.200 18.480 N Ank3 n/a
4 TRCN0000090055 CCACAACTGATGCCTTAACTT pLKO.1 3390 CDS 100% 5.625 7.875 N Ank3 n/a
5 TRCN0000236779 GCAGCGGACACGTTAGATAAT pLKO_005 1679 CDS 100% 13.200 10.560 N Ank3 n/a
6 TRCN0000236776 TATTACTCTGCCGGCACATAA pLKO_005 3082 CDS 100% 13.200 10.560 N Ank3 n/a
7 TRCN0000090054 CCGCCTGGTAAAGAGACATAA pLKO.1 1849 CDS 100% 13.200 9.240 N Ank3 n/a
8 TRCN0000090053 CCTGGGAAGATCGAAGCAAAT pLKO.1 4265 CDS 100% 10.800 7.560 N Ank3 n/a
9 TRCN0000090057 GCCTACCAGAAATCTCTGGAA pLKO.1 4439 CDS 100% 0.264 0.158 N Ank3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513139.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.