Transcript: Mouse XM_006513205.3

PREDICTED: Mus musculus ectodysplasin-A receptor (Edar), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Edar (13608)
Length:
3738
CDS:
241..1656

Additional Resources:

NCBI RefSeq record:
XM_006513205.3
NBCI Gene record:
Edar (13608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513205.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368849 TCCTGTGGATACGGCACTAAA pLKO_005 481 CDS 100% 13.200 18.480 N Edar n/a
2 TRCN0000362877 CAGTCACACACCATGGTATAA pLKO_005 2147 3UTR 100% 13.200 10.560 N Edar n/a
3 TRCN0000067841 CCAACTGTGGTGAGAACGAAT pLKO.1 392 CDS 100% 4.950 3.960 N Edar n/a
4 TRCN0000362876 AGTTCTCCAAAGGAGGTTATC pLKO_005 539 CDS 100% 10.800 7.560 N Edar n/a
5 TRCN0000378427 CAACTGTGGTGAGAACGAATA pLKO_005 393 CDS 100% 10.800 7.560 N Edar n/a
6 TRCN0000067842 CCCTGATTATTGCCATGTCTA pLKO.1 869 CDS 100% 4.950 3.465 N Edar n/a
7 TRCN0000059233 CCTCATCATCATGTTCTACAT pLKO.1 918 CDS 100% 4.950 3.465 N EDAR n/a
8 TRCN0000067840 GCTAACACACACGAGGAGAAA pLKO.1 1006 CDS 100% 4.950 3.465 N Edar n/a
9 TRCN0000067839 CCTTGAGAAGACAAGCCGAAT pLKO.1 1365 CDS 100% 4.050 2.835 N Edar n/a
10 TRCN0000067838 GCTCACAAAGTTGGTGCAGAT pLKO.1 1542 CDS 100% 4.050 2.835 N Edar n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513205.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.