Transcript: Mouse XM_006513280.3

PREDICTED: Mus musculus zinc finger and BTB domain containing 7a (Zbtb7a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zbtb7a (16969)
Length:
5571
CDS:
75..1784

Additional Resources:

NCBI RefSeq record:
XM_006513280.3
NBCI Gene record:
Zbtb7a (16969)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513280.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281766 TCGCAACCTGACTCGTATTAA pLKO_005 1774 CDS 100% 15.000 21.000 N Zbtb7a n/a
2 TRCN0000284496 CCATCTGCGAGAAGGTGATTC pLKO_005 1210 CDS 100% 10.800 15.120 N Zbtb7a n/a
3 TRCN0000124244 CCGCTGACAAATGTCTTTCTT pLKO.1 3500 3UTR 100% 5.625 7.875 N Zbtb7a n/a
4 TRCN0000124247 CTTTGCGACGTGGTGATTCTT pLKO.1 171 CDS 100% 5.625 7.875 N Zbtb7a n/a
5 TRCN0000271681 ACTACTACCTGAAGTACTTCA pLKO_005 1105 CDS 100% 4.950 6.930 N Zbtb7a n/a
6 TRCN0000137891 GAACGTGTACGAGATCGACTT pLKO.1 290 CDS 100% 4.050 5.670 N ZBTB7A n/a
7 TRCN0000271738 CGGACGTGTGTGCGTGTATAT pLKO_005 1907 3UTR 100% 13.200 9.240 N Zbtb7a n/a
8 TRCN0000281765 TACGAGTGTAACATCTGTAAA pLKO_005 1284 CDS 100% 13.200 9.240 N Zbtb7a n/a
9 TRCN0000136520 CCAGTACTTCAAGAAGCTGTT pLKO.1 242 CDS 100% 4.050 2.835 N ZBTB7A n/a
10 TRCN0000124248 CGACTGCAATGGCTTGGACTT pLKO.1 692 CDS 100% 4.050 2.835 N Zbtb7a n/a
11 TRCN0000138142 GAAGCACTTTAAGGACGAGGA pLKO.1 1643 CDS 100% 2.160 1.512 N ZBTB7A n/a
12 TRCN0000124245 CGTCAGATTCTGGCGGCTGAT pLKO.1 459 CDS 100% 1.350 0.945 N Zbtb7a n/a
13 TRCN0000124246 CCAGTGCGATAGCTGCTGCAA pLKO.1 1454 CDS 100% 0.880 0.616 N Zbtb7a n/a
14 TRCN0000138519 CCAGGAGAAGCACTTTAAGGA pLKO.1 1637 CDS 100% 3.000 1.800 N ZBTB7A n/a
15 TRCN0000138716 GCCAGTACTTCAAGAAGCTGT pLKO.1 241 CDS 100% 2.640 1.584 N ZBTB7A n/a
16 TRCN0000434057 GAGAAGCCCTACGAGTGTAAC pLKO_005 1275 CDS 100% 10.800 5.400 Y Zfp647 n/a
17 TRCN0000226240 GAGAAGCCCTACGAGTGTAAT pLKO_005 1275 CDS 100% 13.200 6.600 Y LOC676710 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513280.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.