Transcript: Mouse XM_006513376.3

PREDICTED: Mus musculus serglycin (Srgn), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Srgn (19073)
Length:
1118
CDS:
221..679

Additional Resources:

NCBI RefSeq record:
XM_006513376.3
NBCI Gene record:
Srgn (19073)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513376.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077268 CCTCATTAACTCGTAAGGAAT pLKO.1 829 3UTR 100% 4.950 6.930 N Srgn n/a
2 TRCN0000077269 CCACAGTTTGACCTAATAGAT pLKO.1 377 CDS 100% 5.625 4.500 N Srgn n/a
3 TRCN0000077271 CTCCCATGAATAATCCTGTTT pLKO.1 417 CDS 100% 4.950 3.960 N Srgn n/a
4 TRCN0000428975 ACTTAGTGTACCACGTTTAAA pLKO_005 731 3UTR 100% 15.000 10.500 N Srgn n/a
5 TRCN0000077270 CCAACAGATGAAAGCAATATT pLKO.1 578 CDS 100% 15.000 10.500 N Srgn n/a
6 TRCN0000435263 CTCCATGTGGAACAATGTATT pLKO_005 704 3UTR 100% 13.200 9.240 N Srgn n/a
7 TRCN0000427101 AGACCAACCAGAAGACGATTT pLKO_005 649 CDS 100% 10.800 7.560 N Srgn n/a
8 TRCN0000435414 GATCTTCAGTGCAAGGTTATC pLKO_005 279 CDS 100% 10.800 7.560 N Srgn n/a
9 TRCN0000077272 GCTTCCTAGGTGACATGGAAT pLKO.1 546 CDS 100% 4.950 3.465 N Srgn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513376.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.