Transcript: Mouse XM_006513405.3

PREDICTED: Mus musculus premelanosome protein (Pmel), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pmel (20431)
Length:
2179
CDS:
192..2072

Additional Resources:

NCBI RefSeq record:
XM_006513405.3
NBCI Gene record:
Pmel (20431)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513405.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416427 GACTGTGTTCTATATCGATAT pLKO_005 1509 CDS 100% 10.800 15.120 N Pmel n/a
2 TRCN0000011953 CTGGACATTGTCCAGGGTATT pLKO.1 1548 CDS 100% 1.080 1.512 N Pmel n/a
3 TRCN0000436328 TCCGAAGAGAAGCTTTGTTTA pLKO_005 620 CDS 100% 13.200 10.560 N Pmel n/a
4 TRCN0000428668 CCTACACTGGTTGGTGCAAAT pLKO_005 411 CDS 100% 10.800 8.640 N Pmel n/a
5 TRCN0000011956 CGACACCATAATGCTTGTGAA pLKO.1 1472 CDS 100% 4.950 3.960 N Pmel n/a
6 TRCN0000011954 CCAAGACAACTTGTAACTAAA pLKO.1 294 CDS 100% 13.200 9.240 N Pmel n/a
7 TRCN0000419851 CCAACAACACCATCATCAATG pLKO_005 502 CDS 100% 10.800 7.560 N Pmel n/a
8 TRCN0000423191 CCTTGCATCTCTGATACATAG pLKO_005 1919 CDS 100% 10.800 7.560 N Pmel n/a
9 TRCN0000415691 GACCTCAGCGGTCATAGATAC pLKO_005 1289 CDS 100% 10.800 7.560 N Pmel n/a
10 TRCN0000011957 TCAGGGACATATTGCCTCAAT pLKO.1 1773 CDS 100% 4.950 3.465 N Pmel n/a
11 TRCN0000011955 CCACAGTTGTACAAATGCCAA pLKO.1 1231 CDS 100% 2.640 1.848 N Pmel n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513405.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.