Transcript: Mouse XM_006513412.3

PREDICTED: Mus musculus solute carrier family 16 (monocarboxylic acid transporters), member 7 (Slc16a7), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc16a7 (20503)
Length:
2761
CDS:
780..2234

Additional Resources:

NCBI RefSeq record:
XM_006513412.3
NBCI Gene record:
Slc16a7 (20503)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513412.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079572 GCTGGTAAATTGCTTGATATA pLKO.1 1953 CDS 100% 13.200 18.480 N Slc16a7 n/a
2 TRCN0000079570 CGCTTGGATATCGTCCATCAT pLKO.1 956 CDS 100% 4.950 6.930 N Slc16a7 n/a
3 TRCN0000079568 CGCACCTGAGTTGTGATGAAA pLKO.1 2469 3UTR 100% 5.625 3.938 N Slc16a7 n/a
4 TRCN0000079569 CGTGTTAGTATCAGGTACTTA pLKO.1 2015 CDS 100% 5.625 3.938 N Slc16a7 n/a
5 TRCN0000079571 GTCTCCTCTTTGAATGCCTTA pLKO.1 1843 CDS 100% 4.050 2.835 N Slc16a7 n/a
6 TRCN0000038506 GCTCCTTTCAATCAGTACCTT pLKO.1 1266 CDS 100% 3.000 4.200 N SLC16A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513412.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.