Transcript: Mouse XM_006513473.3

PREDICTED: Mus musculus hexokinase domain containing 1 (Hkdc1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hkdc1 (216019)
Length:
2136
CDS:
105..2057

Additional Resources:

NCBI RefSeq record:
XM_006513473.3
NBCI Gene record:
Hkdc1 (216019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513473.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378502 ATCTCGGAGGATCCAAGTTTC pLKO_005 355 CDS 100% 10.800 8.640 N Hkdc1 n/a
2 TRCN0000221709 GCGCATGTACAACAAGATCTT pLKO.1 1754 CDS 100% 4.950 3.960 N Hkdc1 n/a
3 TRCN0000221710 CAATGAAATCACCCGTGGGAA pLKO.1 449 CDS 100% 2.640 2.112 N Hkdc1 n/a
4 TRCN0000361997 CAACTGTGAAGTCGGCGTTAT pLKO_005 770 CDS 100% 10.800 7.560 N Hkdc1 n/a
5 TRCN0000221708 GCCAAAGTTGGTCTCCTGTTT pLKO.1 1044 CDS 100% 4.950 3.465 N Hkdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513473.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.