Transcript: Mouse XM_006513474.1

PREDICTED: Mus musculus storkhead box 1 (Stox1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stox1 (216021)
Length:
3402
CDS:
274..2925

Additional Resources:

NCBI RefSeq record:
XM_006513474.1
NBCI Gene record:
Stox1 (216021)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252640 CCGGAACAATGCCGTGATAAA pLKO_005 1594 CDS 100% 13.200 10.560 N Stox1 n/a
2 TRCN0000252643 CTAGGCTCCCACTTGATATAT pLKO_005 1387 CDS 100% 15.000 10.500 N Stox1 n/a
3 TRCN0000252639 AGAGCCTGGTATCTACTAATT pLKO_005 2783 CDS 100% 13.200 9.240 N Stox1 n/a
4 TRCN0000252641 GATTCCTCTAAAGAGGTAATT pLKO_005 1153 CDS 100% 13.200 9.240 N Stox1 n/a
5 TRCN0000252642 GATGTGGAACATGCGCTAATC pLKO_005 1003 CDS 100% 10.800 7.560 N Stox1 n/a
6 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 3301 3UTR 100% 2.640 1.320 Y BC028528 n/a
7 TRCN0000201143 CCAAAGGTCCTGAGTTCAAAT pLKO.1 3293 3UTR 100% 13.200 6.600 Y Ptcra n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.