Transcript: Mouse XM_006513494.1

PREDICTED: Mus musculus strawberry notch homolog 2 (Drosophila) (Sbno2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sbno2 (216161)
Length:
4690
CDS:
222..4271

Additional Resources:

NCBI RefSeq record:
XM_006513494.1
NBCI Gene record:
Sbno2 (216161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098083 CCTACAGATTGTGCGCCTTAA pLKO.1 3776 CDS 100% 10.800 15.120 N Sbno2 n/a
2 TRCN0000098081 CCTGGCATCAACGAGATACAT pLKO.1 3240 CDS 100% 5.625 4.500 N Sbno2 n/a
3 TRCN0000098084 GCCTGGATAGCGACTTCAATT pLKO.1 2188 CDS 100% 13.200 9.240 N Sbno2 n/a
4 TRCN0000098080 GAGAGCTGGTAACTCAGGAAA pLKO.1 4463 3UTR 100% 4.950 3.465 N Sbno2 n/a
5 TRCN0000098082 GCTGAGACCTATGCTGACTAT pLKO.1 798 CDS 100% 4.950 3.465 N Sbno2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.