Transcript: Mouse XM_006513656.1

PREDICTED: Mus musculus thrombospondin type laminin G domain and EAR repeats (Tspear), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tspear (252974)
Length:
2324
CDS:
741..1910

Additional Resources:

NCBI RefSeq record:
XM_006513656.1
NBCI Gene record:
Tspear (252974)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200684 GATGATAATGAGGTGCTAAAT pLKO.1 638 5UTR 100% 13.200 18.480 N Tspear n/a
2 TRCN0000202401 GCGACATTTCACCATTGGGAA pLKO.1 1025 CDS 100% 2.640 3.696 N Tspear n/a
3 TRCN0000190321 CCCTATGAAGCTGACATGAAA pLKO.1 662 5UTR 100% 5.625 4.500 N Tspear n/a
4 TRCN0000201964 CTTCCAGTCGTTCCTGACATT pLKO.1 1451 CDS 100% 4.950 3.960 N Tspear n/a
5 TRCN0000192739 GCCATCTATAAATGGACAGAT pLKO.1 954 CDS 100% 4.950 3.465 N Tspear n/a
6 TRCN0000189903 GCAAACAGTCACAGCTACGAT pLKO.1 1527 CDS 100% 3.000 2.100 N Tspear n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.