Transcript: Mouse XM_006513706.3

PREDICTED: Mus musculus phosphatase domain containing, paladin 1 (Pald1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pald1 (27355)
Length:
4148
CDS:
132..2714

Additional Resources:

NCBI RefSeq record:
XM_006513706.3
NBCI Gene record:
Pald1 (27355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030020 CCCTGTTGTGATCACGTACAA pLKO.1 311 CDS 100% 4.950 6.930 N Pald1 n/a
2 TRCN0000030019 CCTGATGCCAAGTTCACCAAA pLKO.1 2232 CDS 100% 4.950 3.465 N Pald1 n/a
3 TRCN0000030021 GCCATCCAGAAAGAGATCCAT pLKO.1 759 CDS 100% 3.000 2.100 N Pald1 n/a
4 TRCN0000030022 CCTGATCCTCTTTAATGCCTA pLKO.1 2483 CDS 100% 2.640 1.848 N Pald1 n/a
5 TRCN0000030023 CTGTACTTCTATCTGCTCCTA pLKO.1 1422 CDS 100% 2.640 1.848 N Pald1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.